Editor in Chief Frances Wang

Prose Editors Claire Groden

Maura Riley

Rebecca Rothfeld

Poetry Editors Tyler Bradford

Mitchell Jacobs

Art Editor Nook Harquail

Layout Editor Stephanie McFeeters

Treasurer Zeviel Kane

Review Board omas Bao, Laura Bergsten, Will Callan,

Gabriela Josebachvili, Alex Lopez, Sarah Morse,

Andrew Samuels, Carla Yoon

Advisor Cleopatra Mathis

Madeline Lesser 6 She Was

Alexi Pappas 7 Betty, Stood Up

Katherine Kendig 8 Mackinac

Julia Danford 10 Fire, Escape

Madeline Lesser 11 Strangers

Nook Harquail 12 TCTCTAGGTCTATATG...

Melissa Saphier 15 Ghazal

Davide Savenije 16 the landscape

Davide Savenije 17 Untitled

Tyler Bradford 18 Away from here

Michael Chilcote 20 Singularity

Jacob Kupferman 21 Circling Stars

Frances Wang 22 Brooklyn Equinox

Daegwon Chae 23 Eclipse

Michael Chilcote 24 Leaf in Fall

Thomas Owen 25 morning

Madeline Lesser 26 Grapefruit Gods

Rebecca Rothfeld 28 e Botch of Egypt

Sam Ross 31 Landlls

Frances Wang 32 Proprioception

Clarissa Li 33 Still Life

Tyler Bradford 34 Wonderland

Lizzie Short 35 In My Mother’s House

Jacob Kupferman 36 Sunset Over the Connecticut River

Renée Gauthier 38 Spitting Image

Genevieve Mifflin 40 Transitions

Annie Gardner 41 Storm for Breakfast

Billy Zou 42 e Undead

Rebecca Rothfeld 44 Capgras Syndrome

Daegwon Chae 45 Watershed

Henry Russell 46 e Call

www.stonefencereview.com

It’s been a while.

Two years ago, the last print edition of the Stonefence Review was published. While we

continued to exist and function in the same way, the publication switched to an electronic

edition no longer constrained by space or cost. Our readership expanded beyond the

geographical limits of Dartmouth, but in a way, we vanished. While students abroad,

alumni, and complete strangers read Stonefence by the glow of their laptop screens, there was

something ineably missing at the heart of Stonefence, here on campus.

Now, two years later, you hold in your hands the tangible volume of poetry, prose, and art

collected over the past year. Our contributors consist of seniors, freshmen, creative writing

majors, pre-meds, artists, scientists, philosophers, and a host of others, each with something

worthwhile to say. We ask that you take a moment out of your day and spend some time

with us, read a little, get to know each other.

In the end, I’m sad to let go of Stonefence. e editors and board for next year are more than

capable and I am condent that Stonefence will grow under their guidance. My reluctance

about leaving is also in a way, pride in Stonefence. We will all eventually graduate and move

on but Stonefence will be here recording the strong voices of people as they come and go.

We just have to open up and listen.

Fran Wang

Editor in Chief

Madeline Lesser ’13

She Was

e things she was rst: “ANN ROGOLSKY”

etched on an old mandolin in faded child scratch.

And last: cigarettes hidden under the armoire,

the only time she’d ever yelled at us.

But mainly the middle: Ella in black and white

above her bed, drowsy, lusty, crooning

to the piano man. Astrology charts

for her husband, my father, my sister’s

rst lover. Rows of strange wax men,

kneeling or laughing, half-melted

by the Florida sun.

But it was like being in the fth grade,

secretly digging in the mulch for weeks

only to nd that our dinosaur

was the discarded chicken bones

from the teacher’s lunch.

ey were her things.

She wasn’t there.

Alexi Pappas ’12

Betty, Stood Up

Dazzle is sometimes written and hardly said.

I’m going to kill you is often said (in jest)

but never written. Except in the movies, and

in the theater; darkness is broken by yellow

popcorn-crunch, but held constant by the thick

smell of salty butter and the salivating mouth

of Betty in the front row. e movie understands

her—as if it’s a secret shared between the two,

as if the popcorn butter is real. It’s fake. Betty,

the lines are made up…

scribbled but immovable.

To argue with lines is a waste of time,

and you have been stood up.

e theater is empty—

e paint doesn’t count, nor the chair, curtains, or screen…

Just Betty,

and the note in her hand:

I hope you read this alone

can be read any number of ways.

Betty crunches,

waiting to fall with the popcorn

through the cracks between the seats.

Katherine Kendig ’12

excerpt from Mackinac

As I walked toward the church under the slow ringing of the bells, I tried to think of Marian

stories to tell, so that when people came up to me after the service and asked, “Were you a friend of

hers?” I would have proof of our connection, something substantial to show them that I too had lost

something when Marian left the world. But Marian had never been the type of person who made

for easy anecdotes: she was steady. We’d spend weekends together during the semester sometimes,

watching movies and talking and ordering Chinese, and on Mondays I’d tell people I’d had an

amazing weekend but be hard-pressed to make them understand why.

ere was at least one story I could tell – I’d told it a thousand times, because it was

quintessentially Marian and yet the only story of its kind. It was Marian catching the light, just for a

moment, and glowing with it.

I’d come over to her dorm room one night to nd her comparing paint swatches of o-

white beige with her o-white beige walls.

“What do you think?” she said, showing me the two closest matches. “Whitewashed Taupe

or Summer Sheep?”

I squinted at the blocks of color. ere was the faintest dierence. “Summer Sheep,” I

pronounced. “Why?”

Marian nodded and stepped back. “I’m going to paint my walls,” she said.

I raised an eyebrow skeptically. “You’re going to paint your walls the color they already are?”

I asked.

She cocked her head at me, which was her way of saying I sounded judgmental. I

respectfully removed the skepticism from my face in response.

“I’m going to paint them all sorts of colors, and then I’m going to paint them Summer

Sheep.”

is time I wasn’t judging; I was just confused. “Why?” I asked again.

“Because I’ll always know the color’s underneath,” she said. “And because Home Depot is

having a sale on paint.”

So that was that. We spent an entire weekend painting her walls. ere was no pattern to

it: she’d paint bright swathes of red and cover them with smiley faces, and I spattered the paint on

like Jackson Pollock and made all kinds of owers because they were all I knew how to draw. Friends

would wander in, drag a brush across the wall a couple times and wander out again. On one wall

Marian painted six large purple elephants.

“ey don’t all have trunks,” I commented.

“I know,” she said. “But it’s their ears that make them cute.”

e result was a madness of colors and shapes, as if a hundred Crayola commercials had

exploded. We’d all written our names, somewhere or other, and the date. It was beautiful, and

Marian stood in her doorway looking at it all and grinning like I’d never seen before.

Two days later the paint was fully dry and Marian opened up six cans of Summer Sheep.

I worked on an essay on her bed in the center of the room while she rolled over our cacophony of

doodles with neat W-shaped strokes. It took three coats to satisfy her that the evidence was well and

truly hidden. When she was done the room looked exactly like it had before – a little better, actually,

because the scu marks on the walls were gone.

“Well,” she said, “that was fun.” She threw away the paintbrushes, and the next weekend we

watched a movie.

e service was beautiful but restrained. ey talked about Marian’s strength and stoicism,

her calm presence, her loyalty. Marian’s mother stood up and said that Marian had been as perfect

and serene as the water surrounding Mackinac. It was odd, to hear a daughter described like that.

After the service I stood outside the church with the tightness of tearstains around my eyes.

I stared at its pristine white siding and wondered if Marian had somehow left an invisible mark

under its gleam, something I could stumble on with a few hours and a paint scraper. Maybe I hadn’t

paid enough attention – maybe everywhere she went she slipped herself into the context. I tried to

picture her poking little pieces of Marian-ity into pillows and underneath drawer linings, or writing

in heavy-papered cookbooks with white ink. I wondered how we had fallen out of touch, exactly.

Who had emailed last? I hoped it was me. I hoped against hope that she had never been lying sick in

a hospital bed on the mainland, wondering idly if I would manage to respond to her last overture of

communication before she was gone, trying to work up the energy to tell me she was sick.

“Were you a friend of hers?”

I blinked away the blinding whiteness of the church and turned to smile a yes at whoever

had asked, but it turned out to be Marian’s mother, and I couldn’t. My face froze, guilty to be caught

even attempting a smile on an occasion that must be hideous to the exhausted woman standing next

to me.

A icker of recognition crossed her features as I turned to face her full on.

“Oh,” she said. “Allie. From school – I recognize you from her pictures.”

I nodded.

“I’m so—” I choked the words out, forcing them from lungs that had suddenly constricted.

“I’m so sorry. I wish there was…” I trailed o, unable to nish the thought. e woman’s daughter

was dead; what did it matter if I wished there was something I could do?

She put her hand on my shoulder. “ank you for coming, Allie,” she said, and turned away.

I almost stopped her. I wanted to tell her the story of Marian’s walls, and give her that

moment of brightness; I wanted to make it worthwhile that I had come. But I thought of Marian

painting those steady Ws over her riotous coloring, without even taking a picture of it rst, and I

thought of the way her mother had described her, and I decided I couldn’t. Not here in the place

where she must have known everyone; where she had been known by everyone, as sweet and stoic

and stable Marian. If Marian wanted her mother to know, she already knew. And if not – well, it was

a useless sort of loyalty, but it felt right.

Madeline Lesser ’13

Strangers

e waves come,

and the people laugh and scream,

the boys, the babies, the men.

Is this all there is?

When the year ends it leaves us

not with memories but with

residues in the bones of things.

Cucumbers become Yustice,

slicing them thin in the kitchen, muttering

Romania, Romania, under his breath.

Year-long lover reduced to the pluck of oss

on teeth, moonlight on turned back,

each blackberry tied to the gap-toothed man

splayed in the street, lost fruits

eddying in gutters,

each pack of cigarettes

to the old friend,

drunk and stumbling,

call me, call me.

When the people die, the furniture

lives on,

and the other people,

all laughing and screaming when the waves come,

when they come again

Julia Danford ’13

Fire, Escape

“Hey, loser

Come climb up

My re

Escape,

Like before.

Come on up, light me up.

Let me burn for you.

Don’t let me

Down.”

Yeah –

I’ve spent enough time on your re escape

To know how to use

One.

Nook Harquail ’14

TCTCTAGGTCTATATGCCTGATAGCAATAAACAATA

AGGACCACTATC TGTTTTGTACTATTTCG

I admit that, in the night, I stole

Into your room, plucked a

Hair from your pillow and

Sent it —midnight airmail— to a

Lab in Tanzania. I’m sorry, but

I just had to know the sequence of

Your soul.

ey say you

Can’t curl your

Tongue, but you

Can wiggle your ears;

at you hate

Apples, fancy

Goulash

Grudgingly;

at you

Can’t quite believe

at there’s life

After death.

ey say: you make

A mean omelette, but

at your

Galantines

Chaud-froid

Congeal, every

Time. You’re

Good

Cause you’ve

Antelope’s speed (

at’s your

Argentinian blood,

Apparently.)

And you

Care so much it

Aches:

About

e starving in

Africa;

About the penguins

Global warming’s

Going to melt;

About the

Children on the

Corner selling lemonade;

About the scantily-

Clad models in

e magazines — You’ll

Always take

e penultimate

Cookie, leaving

e last for me; You’ll

Chase a stranger’s

Gecko all

rough town

To return it

To his arms.

ey say evolution’s

Grown your

ird toe

A quarter

Cm longer

an the average —

And that’s just

e rst page,

ere’s another

ousand, if you

Care to take a

Gander.

Melissa Saphier ’12

Ghazal

Your hands cleave bright segments of orange apart.

I sigh, inhaling the oering. My lips part.

What’s unused: a moldering idea. e junkyard in the gloaming

—violet light, rusted metal breathing. Spare parts.

Is the body whole? Or lacking a human mirror

is it unholy elbows, course curly hair—anatomy, mere parts?

Plunging my hands into cold water, I marvel

at the sworn bond of its molecules, an unscoopable unity: we shall not part.

Moses fares better with water than I.

His sta is a comb. Like hair, the strands of water part.

My tongue seeks yours in darkness. e bed is vast and uncreaking.

Our limbs braid together ecstatically, fall apart.

I will never write poetry again. e loss, shrieking:

there is nothing to write when there is no loss. I’ve lost—what indelible part?

Ah, I can write of nothing but the Melissa condition.

Lies lies lies: what is true for the most part.

Davide Savenije ’12

the landscape

i think

some of the humans are high

up in structures they call

skyscrapers,

full of forecast

for the price of the earth

these days

they make the paper we write on

but little do they know,

they are all coming back to the soil,

where the others are sharpening

the gardening tools

Davide Savenije ’12

Untitled

Tyler Bradford ’14

Away from here

Why are there polar bears in the Bronx?

He took his daughter to the zoo because she asked him to,

he lifted her up on his shoulders, and she squealed with excitement.

Her favorite animal was a polar bear.

ey found the exhibit after an hour of searching,

it was a Tuesday,

they had the exhibit to themselves.

e door on the far side of the tundra opened,

men in uniform emerged carrying a seal

and tossed it onto the ice.

Bears lurch for their meal,

the carcass tears, tears stream down the girl’s face.

She asked her father to take her home.

I put on my school uniform:

stale blue shirt, scratchy red skirt, long gray socks,

and try not to think about

the invisible camera.

e school bus always comes for me in the same spot,

and I’m always stuck

with that seat in the last row.

At school Janie and I eat lunch together,

I don’t really learn anything,

I just hope that one day someone will take me away from this place.

But no one has come yet,

I don’t think they ever will.

I think I have some in my car,

you said.

I waited patiently for you to return.

You came back with bottles instead of cans,

I think that was supposed to impress me.

e ball hit the beer and made a splash.

I was frustrated but I was smiling.

You took me to your room,

the stairs wound and the door swung,

the music came on, we moved between rooms.

You were surprised I was so calm,

I wasn’t.

Light pours through the window:

my cue.

First night a thrill,

I just hope you remember,

sassafras is my safe word.

Michael Chilcote ’12

Singularity

Jacob Kupferman ’14 Circling Stars

Frances Wang ’12

Brooklyn Equinox

Chapped and barbed, my winter skin,

and yours, pale spring,

we walk, shadows dragging through puddles.

Channeled winds push the sun down smooth glass faces.

Dusk, the energy of a city stirs.

Our breath catches charge and sparks,

hurtling one hand down the next, electricity

of taxi cabs and subway tracks jumping gaps

between our matching stride, pacing the Brooklyn Bridge like a comet

stretched over East River.

Nightfall, and our orbit is lit—

binary stars that spin gravity like thread.

We laugh in ellipses along dirty streets,

our sounds trail below, catching the tops of neon signs and

we oat along, combing our hands through numbered streets.

Daegwon Chae ’15

Eclipse

My mother once reminded me that my rst word was apple,

and to this day, I believe it to be the simplest of fruits.

Like all things, it is cyclic, as if it never began—

start with a seed, end with a seed, nothing in between.

To this day, I believe that the simplest of fruits

is nothing more than an idea, a primeval notion that

starts with a seed, ends with a seed, nothing in between.

ere’s no room for life, no mysteries circling its core.

is is nothing more than an idea, a primeval notion,

but if apple is just a word, star is just a dot in the sky.

ere’s no room for life, no mysteries circling its core,

just a never-ending rain of promises, of melted ideas.

Apple is just a word, and star is just a dot in the sky,

but in the winter, snowakes are real. I touched them,

felt the never-ending rain of promises, of melted ideas

rest on my hand. ey were cold, and that’s how I learned

that in the winter, snowakes are real. I touched them.

Since then, I’ve outgrown memories, forgotten how snowakes felt

resting on my hand. ey were cold, and that’s how I learned.

Now, I know to wear gloves on merry-go-rounds in the winter.

Since I’ve outgrown memories and forgotten how snowakes felt,

my mother reminded me that my rst word was apple,

and now I know. I wore gloves on a merry-go-round in the winter,

which, like all things, is cyclic. As if it never began.

Michael Chilcote ’12 Leaf in Fall

omas Owen ’15

morning

i stayed up all night

nger-painting your name

on every part of my body

it was cold on my skin

and it took a long time

which is why i have not slept

now the sun is up and

my heart feels tight and i wonder

if it has changed

it would be nice to hear your voice again

Madeline Lesser ’13

Grapefruit Gods

fruit, n.w

Etymology: Old French fruit < Latin frūctus < frugv- root of fruī -- to use, to enjoy.

— e Oxford English Dictionary

I always thought them useless.

My mother placed clean halves before us

with spoon and knife. Coy girls holding secrets

we could never get to.

We threw them in the neighbor’s pool,

imagining their noses snarling in disgust.

Actually, it was quite beautiful—

a sea of golden, oating orbs.

At night, they glowed like planets,

or moons.

We ate them every day, we began

to worship the grapefruit, savored

the bitter white lm, ate them whole,

with our teeth. We held grapefruit

séances, called on the ancestors with

a tower of fruits between us.

When our skin turned pink, we moved

to Mexico. Became grapefruit gods.

Herded them through the cracked dust streets

until they were brown as the children

who grabbed them, and ran. We fed them to

the hungry dogs. Let them roll free,

rubbed their scent on our naked bodies,

clothed ourselves in the thick yellow skin.

Our mother has stopped calling. e priest weeps

for us in the white stone chapel. We are growing

old under the bougainvillea and when the cacti

prick our skin, the sweet juice runs.

e grapefruit tree: she is anything but coy.

You call up for more,

she gives you more. We have not thought

of where we will go. She provides.

At night, we light them on re. e crickets gather.

And the grapefruits, they burn,

whisper, paradise.

Rebecca Rothfeld ’14

e Botch of Egypt

e LORD will smite thee with the botch of Egypt, and with the emerods, and with the scab, and

with the itch, whereof thou canst not be healed.

- Deuteronomy 28:27

Her left knee itched. She thought it might be rude to interrupt his grunting eorts

or to cease her approving yelping or even to readjust so the weight of him no longer rested

on the oending knee; she felt it was her obligation to appear at all times consumed by

a pleasure so intense it bordered on pain, a pleasure inhabiting her so completely that it

dispelled internal narratives and minor sensations of thirst or hunger or itchiness, dispelled

even the narrative of consciously dispelling narrative and even the narrative dispelling this.

She felt that even now the distant thrusting above her should incite in her the wildest throes

of primordial rapture. But her left knee itched. She could not think her way around the

itch. All tactile feeling was concentrated in concentric circles of prickling, set into rippling

motion by the impact of this initial itch, ringing the central and original point of irritation.

e knee in question grew enlarged, engorged. It swelled to enormous proportions and cast

shadows over the rest of her body. It expanded to ll the space of her consciousness. e

itching welled up in her ears. e itching rose up in her throat. She could barely guide her

steady moans of imitated pleasure around its obtrusive presence and towards the place where

she estimated his ears might be, ears she imagined were eagerly opened like gaping mouths,

awaiting her vocal commentary and favorable judgment so that they might consume it. But

the itch drowned all this out, diluted all other concentrated thoughts with the strength of

itself, and outsung the highest, loudest peaks of her frantic gasping. e itch commandeered

her musings on the itch, enveloping them, colonizing them, taking them into its own

substance. She itched. She itched and itched and itched. She convulsed with itch. Her skin

crawled with itch. She was only itch.

She heard a distant utterance above her and realized absently that he was addressing

a direct statement to her, to which propriety necessitated she respond (propriety reigning

supreme even here, amidst facial contortions and inhuman groaning and one-leg-trapped

beneath-another and sticky wet sounds of unknown origin issuing from some crevice

presumably hot and damp and private, and how far this was, much to her now jaded

disappointment, from the liaisons she’d dreamt and hoped, where she’d moved inevitably,

with the certainty of instinct and need. Her counterpart was to have known, but how she

could not have said, not only her every want and thought and wish but also her physical

intentions, and he was to have waited ahead for her at some future moment of pleasure and

needing, and here at this crossroads of desire they were to have met and intersected and

dissolved into each other somewhat like sugar and water).

“What?” she said.

“I said, do you like it,” he said.

“Yes,” she said.

“Tell me you like it,” he said.

“I like it,” she said.

“Tell me how much,” he said.

“It itches,” she wailed.

“What?”

“It’s del-itch-ous. Delicious.”

“Good,” he said.

“I need to scratch it.”

“What?”

“No one can…match it.”

(And how dierent this was and continued to be from those immemorial dreams,

dreams almost without origin, preceding her even as she dreamt them, dreams that had

wrinkled the paper of her youthful pillow and quickened the slowly sleeping rhythms of her

adolescent breath, urging her towards awakening, parting her lips with words she could not

name, could not even pronounce, words that left charcoal stains on the white walls of her

throat’s interior when she strove to swallow them).

Meanwhile, the itch. Always the itch. e itch extended in a web of connected

tingling across her thigh. e itch engaged in expansionary endeavors, intent on securing the

area between buttocks and mid-leg. e itch like some imperial army making its maddening

way along uncharted limbs.

She involuntarily raised her arm to scratch it, but corrected herself and directed the

rogue hand instead to his back, where she dug her nails into the mass of him in an act of

fury or maybe an attempt to enter into him and detect his itches and unvoiced discomforts

so as to relieve them. is tactic yielding nothing, nothing but endless itch. She struggled to

remain considerate. She clutched at him and delivered the customary avowals and entreaties

in convincingly breathless tones.

Strange, then, that she was disappointed by his inability to recognize her artice,

to perceive the itch, despite her every eort to conceal it. Even after the last high-pitched

squeal of her feigned climax had died away, when he lay beside her with his hand in her hair,

telling her he loved her, and she gazed at him adoringly and whimpered weakly for additional

theatrical eect, she felt no pride in her performance.

“Do you love me?” she asked.

“Of course,” he said.

“Do you promise?” she said.

“I promise,” he said.

“I have to pee,” she said.

In the bathroom, she rubbed a rough towel over her itchy knee until it was smeared

with watery blood. She put it back folded so as to conceal the stains. en she went to bed

and tried to sleep but it was too hot and his arm was angled under her uncomfortably and

she didn’t want to wake him, more out of a deep-seated fear of awkwardness than out of

actual consideration for his well-being, so she watched the dim glow of the digital clock

changing hourly forms and resumed intermittently scratching.

Sam Ross ’12

Landlls

Memorabilia mash-up mountains –

Whose fountain of youth have you found?

Only antiques truly appreciate

eachother,

Especially underground, where

[by the sound]

ey’re the only ones

around.

It’s a little like

A billion bits of photographs,

Snapshots of places

torn from the past

And all stitched together

Like a back-alley skin graft.

It’s a 1920’s speak-easy poster

Plastered on Intel’s Pentium Processor

It fell outside the tourist’s guide this time.

It’s whale-oil lamps

Buried deep in gutters

Whose petroleum sputters

Are as long-lost

As lovers, so

we forget that we will be buried.

Frances Wang ’12

Proprioception

From Latin, proprius: one’s own. e unconscious perception of movement and spatial orientation.

-American Heritage Medical Dictionary

ey say that dogs are soulless.

Mine sleeps on his side and skitters after rabbits

or some such, the limbs of his own knowing stretch

and convulse, propelling him bound for bound

as he turns on the linoleum,

pinned and pivoted around his heart on the oor.

I, too, have chased and been chased.

I have run ragged and woke

thrashing, cold in the sudden

rediscovery of orientation

in the space you and I used to share.

We are both in love, I think,

with distance.

In each human there exists

a secret memory of the ocean,

uid spirals in the chambers of the ear.

It is here I perceive our component places

and angles and the space between us,

the inclination to face each other,

give chase like some darting rabbit.

Seven hours apart,

we anchor ourselves to opposite ends of the horizon,

focusing too intently upon waking

to hear what we ask of each other.

I go unanswered for now, like a good question.

Clarissa Li ’15

Still Life

Tyler Bradford ’14

Wonderland

Art splattered on the wall in concentric circles,

it seems to spell something, but she can’t quite make it out.

e wooden panels on the oor creak with each step she takes:

splinters hurt.

Walk warily—the oorboards might cave.

Autographs line the walls—some are etched, some are painted,

ea market furniture is placed awkwardly throughout the rooms.

A young body face down on a couch:

Alice checks to make sure he is still breathing.

She opens the door to the stairs and sees a neon swirl,

reminds her of the color in the world.

A constant bass resonating from each room quakes the foundation—

not quite music to her ears—

threatens the structure’s ght against gravity.

Breathe.

Fumes torture lungs as they gasp for air,

oxygen is better spent on marlboros.

Grime corrodes the metal sink; silver turns to sea green.

Why doesn’t the refrigerator work?

Music from below resonates weak,

the life seems to have died.

e shattered window lets in cool air from outside,

Alice notices the hair sticking up on her arm,

walks by ea market furniture, the boy has risen,

pulls at his hair but it won’t come out.

A girl in the corner ingests a pill

to release creativity.

Alice turns to the doors but it’s stuck,

so is she. Just kick it down.

Free love requires payment in full.

Wipe that grime o your hands, Alice;

no one is going to do it for you.

Creativity creates the evil as well.

Lizzie Short ’12

In My Mother’s House

Little light bottles

For medicine once, now for sun

A sh-shaped bottle, a turquoise one, bright blue

A light-refracting disk, so that our kitchen can be painted

In all the moving colors in the morning.

It is night now.

My mother and I in my parents’ big bed

Watching a PBS programme

Of Peter, Paul, and Mary

By lamplight.

My mother, so thin and small, in her classic post-9pm repose;

Hair: slightly damp. A glass of white wine

And her nightly dose of PBS.

My mother, with her pert chin jutting against her navy pajama shirt

Sings along

With Peter, Paul, and Mary.

“is song came out when I was thirteen.”

My eyes burn with hot salt as I think of

My dear, skinny, little thirteen-year-old mother

Listening to Peter, Paul and Mary on the radio

In the kitchen of her Cambridge apartment

A kitchen without light bottles or rainbows

A kitchen two streets down

From her best friend, Janie Quinn.

Jacob Kupferman ’14

Sunset Over the Connecticut River

Renée Gauthier ‘12

Spitting Image

e rst thing most people noticed about Amy Healey’s four-year-old daughter

Kelsey was that she was a miniature version of her mother. She had Amy’s brown eyes, her

dishwater-blonde hair, and just the right amount of age-appropriate chubbiness. She was,

by all accounts, an adorable little girl, except for when she was in the throes of an occasional

temper tantrum. Unfortunately for all involved, now was one of those times.

“I don’t like that dress!” she screamed, wiggling and waving her arms as her mother

tried to grab one of the dangerously ailing limbs and stu it into the sleeve of the oending

garment. “I don’t like it!!!”

“You liked it just ne when we picked it out,” Amy said impatiently. “Stop moving,

Kelsey!”

Kelsey redoubled her eorts to wriggle free and began wailing, “No-no-no-no-

no- nooooo!” Amy ignored her and yanked the sleeve further up her daughter’s arm before

turning her attention to the other side of the outt. She glared at a few nearby mothers who

were casting critical looks in her direction and caught Kelsey’s other hand, guiding it with

some diculty into the other sleeve. Her movements thus restricted, Kelsey let out a long,

wordless wail and dissolved into tears, standing stock-still as her mother zippered her up the

back.

“You’d think I was torturing you,” Amy said in what she hoped was a lighthearted

voice, mostly for the benet of the holier-than-thou mothers still watching. “Don’t you like

this dress? Isn’t it pretty?” She glanced over at the mothers and gave them an apologetic smile.

“She’s always like this before a big one. It’s the nerves.” A couple of the mothers nodded

in understanding and turned away, but one or two let their gazes linger on disapprovingly.

Amy tried to ignore them. It was always like this on the pageant circuit. Some mothers just

couldn’t stand the fact that other women’s daughters were cuter or more talented or more

poised. Amy prided herself on her own attitude. She never resorted to the nasty looks or the

passive-aggressive comments that came so naturally to some of the other moms. Pageants

were her own thing, hers and Kelsey’s, and all that mattered was Kelsey’s own performance.

And Kelsey’s performances were always winners.

At home, Kelsey’s bedroom was lled with trophies that proclaimed her Little Miss

is or at. Her walls were hung with sashes and medals, and she had so many tiaras that

almost all of her dolls and stued animals wore at least one. Sometimes when Amy was

returning some misplaced toys to Kelsey’s room or putting some clean laundry in the dresser,

she would just stop and stare at the titles—Grand Supreme, Ultimate Grand Supreme, Junior

Miss Elite, Queen of Queens—and marvel at what she and Kelsey had been able to achieve

together. It was unfortunate that pageants got such a bad rap, she would muse as she blew

some dust o a trophy and straightened a teddy bear’s lopsided crown. Kelsey was learning

poise. She was developing a skill. Not many kids got those kinds of opportunities so early

on—Amy certainly hadn’t.

She found herself thinking along the same lines as she managed to get a subdued

but still sulking Kelsey into a chair to have her hair done and her make-up touched up.

Kelsey would have the world at her feet. She could be a model, an actress, maybe even Miss

America. She could win a scholarship to college, a good college, not a two-year commuter

school like the one Amy had attended, the one that lost its accreditation the same year that

Kelsey was born. She would have dozens—no, hundreds—of options.

It was hard to explain all of this to a six-year-old, so Amy didn’t try. Instead, she

teased Kelsey’s hair and some lighter blonde extensions into a glamorous-looking pouf, curled

the ends, and hairsprayed the hell out of it while Kelsey shielded her face with her hands.

She reapplied the makeup where the tear tracks from Kelsey’s tantrum had messed it up and

brushed some bronzer on top. She successfully inserted the ipper teeth to hide the gaps

where Kelsey’s baby teeth had fallen out. And nally, she managed to get colored contacts

into Kelsey’s eyes. is of course resulted in another tantrum and more makeup-retouching,

but by the end of the entire ordeal Kelsey looked picture perfect. e deep turquoise dress

made the blue contact lenses pop, and Amy couldn’t help but feel satised that they’d decided

to try the contacts—they really completed the look. She applied a dusting of glitter to

Kelsey’s face, gave her two air kisses so as not to ruin the work of the last hour, and sent her

o—tanned, blonde, and sparkly—to wait her turn in the wings.

When Amy took a seat in the audience a few minutes later, the woman next to her

smiled at her. “Which one’s yours?” she asked, jerking her head toward the stage, where all

the contestants were parading out in a wobbly line. Amy told her.

“I’d never’ve guessed,” the woman remarked politely. “She doesn’t look a bit like

you.”

And under the stage lights, with makeup and blonde hair and blue eyes and perfect

teeth and a pretty dress, she didn’t.

Annie Gardner ’15

Storm for Breakfast

When we woke up the clouds had spread

across the sky like grape jam.

Big dark purple clumps

making the air heavy and sticky.

Waking up next to you I expected

the clouds to crack like an egg,

exposing a round yellow yolk

sliding across a blue pan.

But you burnt the toast

And covered it up with grape jam.

Genevieve Miin ’14

Transitions

Billy Zou ’12

excerpt from e Undead

ough I know that evenin’s empire has returned into sand

Vanished from my hand

Left me blindly here to stand but still not sleeping

My weariness amazes me, I’m branded on my feet

I have no one to meet

And the ancient empty street’s too dead for dreaming

— Bob Dylan

Claire wades through the room with a half-empty wineglass and nds Emma by the bar with

Will. —Hey Em, you should probably see this.

—What’s up? She asks, but Claire’s expression is serious. e three of them make their way

back through the crowd toward the French windows leading to the balcony.

ey step out onto the balcony with its white balusters, and look out across the street.

—Can you see who it is? asks Will.

Emma can see, and she feels the panic well up inside of her. Her senses sharpen and the

alcohol drains from her head. She feels her heart race, the air press up against her lungs.

—You guys should go back inside.

Claire nods. —Should I call S&S?

Emma thinks. —No, don’t. Her eyes trace out the scene. She can hear the two boys shouting

from the street and Robert’s roaring voice from the open second-story window.

—Dude you can’t get on the roof and then not jump. What kind of shit is that.

—You need to fuck o right now.

Claire puts her hand on Will’s shoulder. —Come on.

—I’ll wait for Emma. Shouldn’t we call S&S?

—She’ll be right in. Claire brings him inside and whispers something but they stand and

watch by the window.

Emma inhales sharply. —Hey. But her voice dissolves thinly into the commotion. —Hey!

Now they turn their heads to see.

—What’s your name? She calls to them on the street. ey turn away to ignore her, but this

incenses her more. —Hey! I asked you a question. What’s your name? I’m talking to you. My

name’s Emma, what’s yours?

Jeremy sees her now. She’s wearing a yellow dress like the one she wore with him to Lake

Champlain. ere had been a formal on a boat out on the lake and music and dancing and

there’d been a girl who had drank too much and fallen overboard, and he’d jumped in and

pulled her out of the water while her date stood there and watched. It makes him dizzy to

think about it now. His knees felt weak and he imagines momentarily the sensation of falling,

the soft loamy impact of earth against his skull.

e boy in the sweatshirt whispers something to his friend. He pulls the hood over his head,

his voice lackluster now and humorless. —We’re not leaving until you jump, so you might as

well get it over with.

Emma knew she had them. —Hey I know who you are! She’s talking to their backs. —You

work in the President’s oce. Your name’s Colin and his is Parker. You, you’re one of the

Tucker chairs, aren’t you? I think we took a skiing class together one time.

—What the fuck? ey try to laugh it o. —Who is this girl? Do you know her?

—Let’s go, I don’t want anything to do with this.

—He’s not going to do it, let’s go.

One of them shouts back to her. —Hey, I don’t who you’re talking about. ey walk o

slowly toward the library, their forms folding into the shadows, join once more the lurching,

faceless gures of night.

Emma exhales. —Jeremy you idiot, get o the roof. Go inside, you’re drunk.

—We were playing zombies. He smiles.

ey stand there for a minute, her on the balcony and him on the roof. Emma with her

hands curled up against the railing, Jeremy with his hands in his pockets, shoulders leaned

back like he’s out observing the stars, their breath fogging up the air between their faces,

and it’s not very far across from one side of Webster to the other or it’s true that the houses

change their places because on some nights it seems that it’s an eternity escaping from the

stale, musty underground to the comfort of the Choates and other nights it’s hardly a walk

and yet others they all melt together indistinguishably...

—Rob help get him back inside, can’t you see he can’t stand straight. He’s going to slip and

fall, he’s going to get arrested.

Robert steps through the window and grabs hold of Jeremy’s shoulder. —Hey, come on. Hey

Jerm. Let’s nd some people with brains.

Jeremy pauses, his back turned to the people watching from the house, then smiling he

reaches out toward her into the night with his limp, undead arms, and Emma looks at him,

and she holds up her hands locked into the shape of a gun, and res a single shot through the

dark, impalpable stillness of Webster Avenue.

Rebecca Rothfeld ’14

Capgras Syndrome

One day you were

no longer you. You’d

swallowed yourself in the deep

of your sleep and escaped

through the door in the side of

your gut. By the time I awoke,

already too late, I noticed

the violate window agape,

long curtains contorted with

unbidden breeze, the covers

drawn back on the bed’s naked

thigh. ere hadn’t been time

for notes or goodbyes, just

enough to collect what you thought

you might need, your books and

your socks, a couple of shirts, old letters

addressed to a self days away.

Strangers in the kitchen are

scrambling eggs. Interred in

the tub I am turning taps cold,

my ngers all wrinkling like rot-ripened

fruit. I plead with your captors

for your safe return. What have they done

with your voice, with your hands? And where

is there room for the greens of your eyes?

No prison could house all these

transient selves, no ransom recover

the bulk of your being, the someone

who shuddered in my sleepy holding

and howled at my partings, demanding

I stay. On the day of

betrayal I’ll unbuild my bearings,

nd my clothing too big and mirrors all

distortive, the shelves lined with books that

I’ve never purchased, and myself

coyly kidnapped: we’ve all been replaced.

Daegwon Chae ’15

Watershed

e night before the weather cleared

it rained for just a minute. And through

the paint-chipped ceiling dropped

a single bead of blue upon

my bedside table. I like to think

the water came from many places:

mist from Japan, fog from the Tropics,

and steam from boiling tea above

a paltry ame that seems like dancing

wisps of golden leaves to lonely

campers in Antarctica.

Henry Russell ’15

e Call

I found my father’s hunting dog nose deep

in a nest of mice behind Sullivan’s lot.

e pink underbelly of the mother

broke in his jaw, spurted blood-arc.

e red, clouding in the snow,

trolled his jawline like wine

down my father’s blushed cheek

in a picture from his wedding night.

I kicked him in the gut with my boot—

the young burrowing out of reach—

and he let her drop. Grey-red esh

and pus smacked snow, heartbeat

under skin, quick as dog years— there,

but hardly ever, like snowakes in streetlamps,

Lindsay sitting on my lap at Verroci’s gate,

my hand, for once, in her silver-red hair.

And now, I see it all:

the tremor on her stomach,

body warmth melting the snow beneath her,

the dog’s back-look, (Is it guilt?)

edging into tree cover.

e only time I snuck back late,

my father caught me, showed for the rst time,

his top front teeth are fake,

the real ones bludgeoned down his throat

by a hulking back, called from the bench

to start at Memorial. at night,

Lindsay left me at drive’s end.

Her dress, dogwood-printed pink,

ushed bare shoulder,

and my gut’s desire to turn back,

deep, and rising. e door cracked

orange glow, and I nd my father,

still up with Kess, hunched

at the desk lamp, teaching himself to read.

Months later, running for distance

in the dusk along her lot, I hear

the call to heart, the turnover of legs

that rip the deer path around her sycamore,

back and back, into the Indian graveyard

like London’s wolf-dog

who never forgot his mother.

As a kid, I put Fang

under my pillow, to pack in dreams

through timber woods, and now,

on the night before we graduate,

I hear it louder than ever—

coyote chatter, play-call for rabbit hunt,

moon-salute against cicada drone.

Her bed lamp, across the hayeld, kindles

nature’s drive for her within me and suddenly,

I’m taken back to a white hall,

the choke in my father’s throat

I barely caught. is woman,

thumbing syringe, signals for me to go,

and, turning,

I catch the back-look of the black mutt,

tired, maybe, of instinct.

at night, I found a manila letterhead

my father, the dyslexic, tucked under my pillow.

How long did it sit there?

A day. Maybe seven.

It said: “We feel what we must.”