Editor in Chief Frances Wang
Prose Editors Claire Groden
Maura Riley
Rebecca Rothfeld
Poetry Editors Tyler Bradford
Mitchell Jacobs
Art Editor Nook Harquail
Layout Editor Stephanie McFeeters
Treasurer Zeviel Kane
Review Board omas Bao, Laura Bergsten, Will Callan,
Gabriela Josebachvili, Alex Lopez, Sarah Morse,
Andrew Samuels, Carla Yoon
Advisor Cleopatra Mathis
Madeline Lesser 6 She Was
Alexi Pappas 7 Betty, Stood Up
Katherine Kendig 8 Mackinac
Julia Danford 10 Fire, Escape
Madeline Lesser 11 Strangers
Nook Harquail 12 TCTCTAGGTCTATATG...
Melissa Saphier 15 Ghazal
Davide Savenije 16 the landscape
Davide Savenije 17 Untitled
Tyler Bradford 18 Away from here
Michael Chilcote 20 Singularity
Jacob Kupferman 21 Circling Stars
Frances Wang 22 Brooklyn Equinox
Daegwon Chae 23 Eclipse
Michael Chilcote 24 Leaf in Fall
Thomas Owen 25 morning
Madeline Lesser 26 Grapefruit Gods
Rebecca Rothfeld 28 e Botch of Egypt
Sam Ross 31 Landlls
Frances Wang 32 Proprioception
Clarissa Li 33 Still Life
Tyler Bradford 34 Wonderland
Lizzie Short 35 In My Mother’s House
Jacob Kupferman 36 Sunset Over the Connecticut River
Renée Gauthier 38 Spitting Image
Genevieve Mifflin 40 Transitions
Annie Gardner 41 Storm for Breakfast
Billy Zou 42 e Undead
Rebecca Rothfeld 44 Capgras Syndrome
Daegwon Chae 45 Watershed
Henry Russell 46 e Call
www.stonefencereview.com
It’s been a while.
Two years ago, the last print edition of the Stonefence Review was published. While we
continued to exist and function in the same way, the publication switched to an electronic
edition no longer constrained by space or cost. Our readership expanded beyond the
geographical limits of Dartmouth, but in a way, we vanished. While students abroad,
alumni, and complete strangers read Stonefence by the glow of their laptop screens, there was
something ineably missing at the heart of Stonefence, here on campus.
Now, two years later, you hold in your hands the tangible volume of poetry, prose, and art
collected over the past year. Our contributors consist of seniors, freshmen, creative writing
majors, pre-meds, artists, scientists, philosophers, and a host of others, each with something
worthwhile to say. We ask that you take a moment out of your day and spend some time
with us, read a little, get to know each other.
In the end, I’m sad to let go of Stonefence. e editors and board for next year are more than
capable and I am condent that Stonefence will grow under their guidance. My reluctance
about leaving is also in a way, pride in Stonefence. We will all eventually graduate and move
on but Stonefence will be here recording the strong voices of people as they come and go.
We just have to open up and listen.
Fran Wang
Editor in Chief
6
7
Madeline Lesser ’13
She Was
e things she was rst: “ANN ROGOLSKY”
etched on an old mandolin in faded child scratch.
And last: cigarettes hidden under the armoire,
the only time shed ever yelled at us.
But mainly the middle: Ella in black and white
above her bed, drowsy, lusty, crooning
to the piano man. Astrology charts
for her husband, my father, my sister’s
rst lover. Rows of strange wax men,
kneeling or laughing, half-melted
by the Florida sun.
But it was like being in the fth grade,
secretly digging in the mulch for weeks
only to nd that our dinosaur
was the discarded chicken bones
from the teachers lunch.
ey were her things.
She wasnt there.
Alexi Pappas ’12
Betty, Stood Up
Dazzle is sometimes written and hardly said.
I’m going to kill you is often said (in jest)
but never written. Except in the movies, and
in the theater; darkness is broken by yellow
popcorn-crunch, but held constant by the thick
smell of salty butter and the salivating mouth
of Betty in the front row. e movie understands
her—as if it’s a secret shared between the two,
as if the popcorn butter is real. It’s fake. Betty,
the lines are made up…
scribbled but immovable.
To argue with lines is a waste of time,
and you have been stood up.
e theater is empty—
e paint doesnt count, nor the chair, curtains, or screen…
Just Betty,
and the note in her hand:
I hope you read this alone
can be read any number of ways.
Betty crunches,
waiting to fall with the popcorn
through the cracks between the seats.
8
9
Katherine Kendig ’12
excerpt from Mackinac
As I walked toward the church under the slow ringing of the bells, I tried to think of Marian
stories to tell, so that when people came up to me after the service and asked,Were you a friend of
hers?” I would have proof of our connection, something substantial to show them that I too had lost
something when Marian left the world. But Marian had never been the type of person who made
for easy anecdotes: she was steady. Wed spend weekends together during the semester sometimes,
watching movies and talking and ordering Chinese, and on Mondays Id tell people I’d had an
amazing weekend but be hard-pressed to make them understand why.
ere was at least one story I could tell I’d told it a thousand times, because it was
quintessentially Marian and yet the only story of its kind. It was Marian catching the light, just for a
moment, and glowing with it.
I’d come over to her dorm room one night to nd her comparing paint swatches of o-
white beige with her o-white beige walls.
“What do you think? she said, showing me the two closest matches. “Whitewashed Taupe
or Summer Sheep?”
I squinted at the blocks of color. ere was the faintest dierence. Summer Sheep, I
pronounced. “Why?”
Marian nodded and stepped back.I’m going to paint my walls,she said.
I raised an eyebrow skeptically. “Youre going to paint your walls the color they already are?
I asked.
She cocked her head at me, which was her way of saying I sounded judgmental. I
respectfully removed the skepticism from my face in response.
Im going to paint them all sorts of colors, and then Im going to paint them Summer
Sheep.
is time I wasnt judging; I was just confused. “Why?” I asked again.
Because Ill always know the colors underneath, she said.And because Home Depot is
having a sale on paint.
So that was that. We spent an entire weekend painting her walls. ere was no pattern to
it: shed paint bright swathes of red and cover them with smiley faces, and I spattered the paint on
like Jackson Pollock and made all kinds of owers because they were all I knew how to draw. Friends
would wander in, drag a brush across the wall a couple times and wander out again. On one wall
Marian painted six large purple elephants.
ey dont all have trunks,” I commented.
“I know,” she said. “But its their ears that make them cute.
e result was a madness of colors and shapes, as if a hundred Crayola commercials had
exploded. Wed all written our names, somewhere or other, and the date. It was beautiful, and
Marian stood in her doorway looking at it all and grinning like I’d never seen before.
Two days later the paint was fully dry and Marian opened up six cans of Summer Sheep.
I worked on an essay on her bed in the center of the room while she rolled over our cacophony of
doodles with neat W-shaped strokes. It took three coats to satisfy her that the evidence was well and
truly hidden. When she was done the room looked exactly like it had before a little better, actually,
because the scu marks on the walls were gone.
“Well,she said, that was fun. She threw away the paintbrushes, and the next weekend we
watched a movie.
e service was beautiful but restrained. ey talked about Marians strength and stoicism,
her calm presence, her loyalty. Marians mother stood up and said that Marian had been as perfect
and serene as the water surrounding Mackinac. It was odd, to hear a daughter described like that.
After the service I stood outside the church with the tightness of tearstains around my eyes.
I stared at its pristine white siding and wondered if Marian had somehow left an invisible mark
under its gleam, something I could stumble on with a few hours and a paint scraper. Maybe I hadnt
paid enough attention maybe everywhere she went she slipped herself into the context. I tried to
picture her poking little pieces of Marian-ity into pillows and underneath drawer linings, or writing
in heavy-papered cookbooks with white ink. I wondered how we had fallen out of touch, exactly.
Who had emailed last? I hoped it was me. I hoped against hope that she had never been lying sick in
a hospital bed on the mainland, wondering idly if I would manage to respond to her last overture of
communication before she was gone, trying to work up the energy to tell me she was sick.
“Were you a friend of hers?
I blinked away the blinding whiteness of the church and turned to smile a yes at whoever
had asked, but it turned out to be Marians mother, and I couldnt. My face froze, guilty to be caught
even attempting a smile on an occasion that must be hideous to the exhausted woman standing next
to me.
A icker of recognition crossed her features as I turned to face her full on.
“Oh,” she said. “Allie. From school – I recognize you from her pictures.
I nodded.
Im so I choked the words out, forcing them from lungs that had suddenly constricted.
“I’m so sorry. I wish there was…” I trailed o, unable to nish the thought. e womans daughter
was dead; what did it matter if I wished there was something I could do?
She put her hand on my shoulder. ank you for coming, Allie,” she said, and turned away.
I almost stopped her. I wanted to tell her the story of Marians walls, and give her that
moment of brightness; I wanted to make it worthwhile that I had come. But I thought of Marian
painting those steady Ws over her riotous coloring, without even taking a picture of it rst, and I
thought of the way her mother had described her, and I decided I couldnt. Not here in the place
where she must have known everyone; where she had been known by everyone, as sweet and stoic
and stable Marian. If Marian wanted her mother to know, she already knew. And if not well, it was
a useless sort of loyalty, but it felt right.
10
11
Madeline Lesser ’13
Strangers
e waves come,
and the people laugh and scream,
the boys, the babies, the men.
Is this all there is?
When the year ends it leaves us
not with memories but with
residues in the bones of things.
Cucumbers become Yustice,
slicing them thin in the kitchen, muttering
Romania, Romania, under his breath.
Year-long lover reduced to the pluck of oss
on teeth, moonlight on turned back,
each blackberry tied to the gap-toothed man
splayed in the street, lost fruits
eddying in gutters,
each pack of cigarettes
to the old friend,
drunk and stumbling,
call me, call me.
When the people die, the furniture
lives on,
and the other people,
all laughing and screaming when the waves come,
when they come again
Julia Danford ’13
Fire, Escape
“Hey, loser
Come climb up
My re
Escape,
Like before.
Come on up, light me up.
Let me burn for you.
Dont let me
Down.
Yeah –
I’ve spent enough time on your re escape
To know how to use
One.
12
13
Nook Harquail ’14
TCTCTAGGTCTATATGCCTGATAGCAATAAACAATA
AGGACCACTATC TGTTTTGTACTATTTCG
I admit that, in the night, I stole
Into your room, plucked a
Hair from your pillow and
Sent it —midnight airmail— to a
Lab in Tanzania. I’m sorry, but
I just had to know the sequence of
Your soul.
ey say you
Cant curl your
Tongue, but you
Can wiggle your ears;
at you hate
Apples, fancy
Goulash
Grudgingly;
at you
Cant quite believe
at theres life
After death.
ey say: you make
A mean omelette, but
at your
Galantines
Chaud-froid
Congeal, every
Time. Youre
Good
At
T
A
G
Cause youve
An
Antelopes speed (
at’s your
Argentinian blood,
Apparently.)
And you
Care so much it
Aches:
About
e starving in
Africa;
About the penguins
Global warmings
Going to melt;
About the
Children on the
Corner selling lemonade;
14
15
About the scantily-
Clad models in
e magazines — You’ll
Always take
e penultimate
Cookie, leaving
e last for me; You’ll
Chase a stranger’s
Gecko all
rough town
To return it
To his arms.
ey say evolutions
Grown your
ird toe
A quarter
Cm longer
an the average —
And that’s just
e rst page,
eres another
ousand, if you
Care to take a
Gander.
Melissa Saphier ’12
Ghazal
Your hands cleave bright segments of orange apart.
I sigh, inhaling the oering. My lips part.
What’s unused: a moldering idea. e junkyard in the gloaming
—violet light, rusted metal breathing. Spare parts.
Is the body whole? Or lacking a human mirror
is it unholy elbows, course curly hair—anatomy, mere parts?
Plunging my hands into cold water, I marvel
at the sworn bond of its molecules, an unscoopable unity: we shall not part.
Moses fares better with water than I.
His sta is a comb. Like hair, the strands of water part.
My tongue seeks yours in darkness. e bed is vast and uncreaking.
Our limbs braid together ecstatically, fall apart.
I will never write poetry again. e loss, shrieking:
there is nothing to write when there is no loss. I’ve lost—what indelible part?
Ah, I can write of nothing but the Melissa condition.
Lies lies lies: what is true for the most part.
16
17
Davide Savenije ’12
the landscape
i think
some of the humans are high
up in structures they call
skyscrapers,
full of forecast
for the price of the earth
these days
they make the paper we write on
but little do they know,
they are all coming back to the soil,
where the others are sharpening
the gardening tools
Davide Savenije ’12
Untitled
18
19
Tyler Bradford ’14
Away from here
1.
Why are there polar bears in the Bronx?
He took his daughter to the zoo because she asked him to,
he lifted her up on his shoulders, and she squealed with excitement.
Her favorite animal was a polar bear.
ey found the exhibit after an hour of searching,
it was a Tuesday,
they had the exhibit to themselves.
e door on the far side of the tundra opened,
men in uniform emerged carrying a seal
and tossed it onto the ice.
Bears lurch for their meal,
the carcass tears, tears stream down the girl’s face.
She asked her father to take her home.
2.
I put on my school uniform:
stale blue shirt, scratchy red skirt, long gray socks,
and try not to think about
the invisible camera.
e school bus always comes for me in the same spot,
and I’m always stuck
with that seat in the last row.
At school Janie and I eat lunch together,
I dont really learn anything,
I just hope that one day someone will take me away from this place.
But no one has come yet,
I dont think they ever will.
3.
I think I have some in my car,
you said.
I waited patiently for you to return.
You came back with bottles instead of cans,
I think that was supposed to impress me.
e ball hit the beer and made a splash.
I was frustrated but I was smiling.
You took me to your room,
the stairs wound and the door swung,
the music came on, we moved between rooms.
You were surprised I was so calm,
I wasnt.
Light pours through the window:
my cue.
First night a thrill,
I just hope you remember,
sassafras is my safe word.
20
21
Michael Chilcote ’12
Singularity
Jacob Kupferman ’14 Circling Stars
22
23
Frances Wang ’12
Brooklyn Equinox
Chapped and barbed, my winter skin,
and yours, pale spring,
we walk, shadows dragging through puddles.
Channeled winds push the sun down smooth glass faces.
Dusk, the energy of a city stirs.
Our breath catches charge and sparks,
hurtling one hand down the next, electricity
of taxi cabs and subway tracks jumping gaps
between our matching stride, pacing the Brooklyn Bridge like a comet
stretched over East River.
Nightfall, and our orbit is lit—
binary stars that spin gravity like thread.
We laugh in ellipses along dirty streets,
our sounds trail below, catching the tops of neon signs and
we oat along, combing our hands through numbered streets.
Daegwon Chae ’15
Eclipse
My mother once reminded me that my rst word was apple,
and to this day, I believe it to be the simplest of fruits.
Like all things, it is cyclic, as if it never began—
start with a seed, end with a seed, nothing in between.
To this day, I believe that the simplest of fruits
is nothing more than an idea, a primeval notion that
starts with a seed, ends with a seed, nothing in between.
eres no room for life, no mysteries circling its core.
is is nothing more than an idea, a primeval notion,
but if apple is just a word, star is just a dot in the sky.
eres no room for life, no mysteries circling its core,
just a never-ending rain of promises, of melted ideas.
Apple is just a word, and star is just a dot in the sky,
but in the winter, snowakes are real. I touched them,
felt the never-ending rain of promises, of melted ideas
rest on my hand. ey were cold, and that’s how I learned
that in the winter, snowakes are real. I touched them.
Since then, I’ve outgrown memories, forgotten how snowakes felt
resting on my hand. ey were cold, and that’s how I learned.
Now, I know to wear gloves on merry-go-rounds in the winter.
Since I’ve outgrown memories and forgotten how snowakes felt,
my mother reminded me that my rst word was apple,
and now I know. I wore gloves on a merry-go-round in the winter,
which, like all things, is cyclic. As if it never began.
24
25
Michael Chilcote ’12 Leaf in Fall
omas Owen ’15
morning
i stayed up all night
nger-painting your name
on every part of my body
it was cold on my skin
and it took a long time
which is why i have not slept
now the sun is up and
my heart feels tight and i wonder
if it has changed
it would be nice to hear your voice again
26
27
Madeline Lesser ’13
Grapefruit Gods
fruit, n.w
Etymology: Old French fruit < Latin frūctus < frugv- root of fruī -- to use, to enjoy.
e Oxford English Dictionary
I always thought them useless.
My mother placed clean halves before us
with spoon and knife. Coy girls holding secrets
we could never get to.
We threw them in the neighbors pool,
imagining their noses snarling in disgust.
Actually, it was quite beautiful—
a sea of golden, oating orbs.
At night, they glowed like planets,
or moons.
We ate them every day, we began
to worship the grapefruit, savored
the bitter white lm, ate them whole,
with our teeth. We held grapefruit
séances, called on the ancestors with
a tower of fruits between us.
When our skin turned pink, we moved
to Mexico. Became grapefruit gods.
Herded them through the cracked dust streets
until they were brown as the children
who grabbed them, and ran. We fed them to
the hungry dogs. Let them roll free,
rubbed their scent on our naked bodies,
clothed ourselves in the thick yellow skin.
Our mother has stopped calling. e priest weeps
for us in the white stone chapel. We are growing
old under the bougainvillea and when the cacti
prick our skin, the sweet juice runs.
e grapefruit tree: she is anything but coy.
You call up for more,
she gives you more. We have not thought
of where we will go. She provides.
At night, we light them on re. e crickets gather.
And the grapefruits, they burn,
whisper, paradise.
28
29
Rebecca Rothfeld ’14
e Botch of Egypt
e LORD will smite thee with the botch of Egypt, and with the emerods, and with the scab, and
with the itch, whereof thou canst not be healed.
- Deuteronomy 28:27
Her left knee itched. She thought it might be rude to interrupt his grunting eorts
or to cease her approving yelping or even to readjust so the weight of him no longer rested
on the oending knee; she felt it was her obligation to appear at all times consumed by
a pleasure so intense it bordered on pain, a pleasure inhabiting her so completely that it
dispelled internal narratives and minor sensations of thirst or hunger or itchiness, dispelled
even the narrative of consciously dispelling narrative and even the narrative dispelling this.
She felt that even now the distant thrusting above her should incite in her the wildest throes
of primordial rapture. But her left knee itched. She could not think her way around the
itch. All tactile feeling was concentrated in concentric circles of prickling, set into rippling
motion by the impact of this initial itch, ringing the central and original point of irritation.
e knee in question grew enlarged, engorged. It swelled to enormous proportions and cast
shadows over the rest of her body. It expanded to ll the space of her consciousness. e
itching welled up in her ears. e itching rose up in her throat. She could barely guide her
steady moans of imitated pleasure around its obtrusive presence and towards the place where
she estimated his ears might be, ears she imagined were eagerly opened like gaping mouths,
awaiting her vocal commentary and favorable judgment so that they might consume it. But
the itch drowned all this out, diluted all other concentrated thoughts with the strength of
itself, and outsung the highest, loudest peaks of her frantic gasping. e itch commandeered
her musings on the itch, enveloping them, colonizing them, taking them into its own
substance. She itched. She itched and itched and itched. She convulsed with itch. Her skin
crawled with itch. She was only itch.
She heard a distant utterance above her and realized absently that he was addressing
a direct statement to her, to which propriety necessitated she respond (propriety reigning
supreme even here, amidst facial contortions and inhuman groaning and one-leg-trapped
beneath-another and sticky wet sounds of unknown origin issuing from some crevice
presumably hot and damp and private, and how far this was, much to her now jaded
disappointment, from the liaisons shed dreamt and hoped, where shed moved inevitably,
with the certainty of instinct and need. Her counterpart was to have known, but how she
could not have said, not only her every want and thought and wish but also her physical
intentions, and he was to have waited ahead for her at some future moment of pleasure and
needing, and here at this crossroads of desire they were to have met and intersected and
dissolved into each other somewhat like sugar and water).
“What?” she said.
“I said, do you like it,” he said.
“Yes,” she said.
“Tell me you like it,” he said.
“I like it,” she said.
“Tell me how much,” he said.
“It itches,” she wailed.
“What?”
“It’s del-itch-ous. Delicious.
“Good,” he said.
“I need to scratch it.
“What?”
“No one can…match it.
(And how dierent this was and continued to be from those immemorial dreams,
dreams almost without origin, preceding her even as she dreamt them, dreams that had
wrinkled the paper of her youthful pillow and quickened the slowly sleeping rhythms of her
adolescent breath, urging her towards awakening, parting her lips with words she could not
name, could not even pronounce, words that left charcoal stains on the white walls of her
throats interior when she strove to swallow them).
30
31
Meanwhile, the itch. Always the itch. e itch extended in a web of connected
tingling across her thigh. e itch engaged in expansionary endeavors, intent on securing the
area between buttocks and mid-leg. e itch like some imperial army making its maddening
way along uncharted limbs.
She involuntarily raised her arm to scratch it, but corrected herself and directed the
rogue hand instead to his back, where she dug her nails into the mass of him in an act of
fury or maybe an attempt to enter into him and detect his itches and unvoiced discomforts
so as to relieve them. is tactic yielding nothing, nothing but endless itch. She struggled to
remain considerate. She clutched at him and delivered the customary avowals and entreaties
in convincingly breathless tones.
Strange, then, that she was disappointed by his inability to recognize her artice,
to perceive the itch, despite her every eort to conceal it. Even after the last high-pitched
squeal of her feigned climax had died away, when he lay beside her with his hand in her hair,
telling her he loved her, and she gazed at him adoringly and whimpered weakly for additional
theatrical eect, she felt no pride in her performance.
“Do you love me?” she asked.
“Of course,” he said.
“Do you promise?” she said.
“I promise,” he said.
“I have to pee,” she said.
In the bathroom, she rubbed a rough towel over her itchy knee until it was smeared
with watery blood. She put it back folded so as to conceal the stains. en she went to bed
and tried to sleep but it was too hot and his arm was angled under her uncomfortably and
she didnt want to wake him, more out of a deep-seated fear of awkwardness than out of
actual consideration for his well-being, so she watched the dim glow of the digital clock
changing hourly forms and resumed intermittently scratching.
Sam Ross ’12
Landlls
Memorabilia mash-up mountains –
Whose fountain of youth have you found?
Only antiques truly appreciate
eachother,
Especially underground, where
[by the sound]
eyre the only ones
around.
It’s a little like
A billion bits of photographs,
Snapshots of places
torn from the past
And all stitched together
Like a back-alley skin graft.
It’s a 1920’s speak-easy poster
Plastered on Intel’s Pentium Processor
It fell outside the tourist’s guide this time.
It’s whale-oil lamps
Buried deep in gutters
Whose petroleum sputters
Are as long-lost
As lovers, so
we forget that we will be buried.
32
33
Frances Wang ’12
Proprioception
From Latin, proprius: one’s own. e unconscious perception of movement and spatial orientation.
-American Heritage Medical Dictionary
ey say that dogs are soulless.
Mine sleeps on his side and skitters after rabbits
or some such, the limbs of his own knowing stretch
and convulse, propelling him bound for bound
as he turns on the linoleum,
pinned and pivoted around his heart on the oor.
I, too, have chased and been chased.
I have run ragged and woke
thrashing, cold in the sudden
rediscovery of orientation
in the space you and I used to share.
We are both in love, I think,
with distance.
In each human there exists
a secret memory of the ocean,
uid spirals in the chambers of the ear.
It is here I perceive our component places
and angles and the space between us,
the inclination to face each other,
give chase like some darting rabbit.
Seven hours apart,
we anchor ourselves to opposite ends of the horizon,
focusing too intently upon waking
to hear what we ask of each other.
I go unanswered for now, like a good question.
Clarissa Li ’15
Still Life
34
35
Tyler Bradford ’14
Wonderland
Art splattered on the wall in concentric circles,
it seems to spell something, but she cant quite make it out.
e wooden panels on the oor creak with each step she takes:
splinters hurt.
Walk warily—the oorboards might cave.
Autographs line the walls—some are etched, some are painted,
ea market furniture is placed awkwardly throughout the rooms.
A young body face down on a couch:
Alice checks to make sure he is still breathing.
She opens the door to the stairs and sees a neon swirl,
reminds her of the color in the world.
A constant bass resonating from each room quakes the foundation—
not quite music to her ears—
threatens the structures ght against gravity.
Breathe.
Fumes torture lungs as they gasp for air,
oxygen is better spent on marlboros.
Grime corrodes the metal sink; silver turns to sea green.
Why doesnt the refrigerator work?
Music from below resonates weak,
the life seems to have died.
e shattered window lets in cool air from outside,
Alice notices the hair sticking up on her arm,
walks by ea market furniture, the boy has risen,
pulls at his hair but it wont come out.
A girl in the corner ingests a pill
to release creativity.
Alice turns to the doors but it’s stuck,
so is she. Just kick it down.
Free love requires payment in full.
Wipe that grime o your hands, Alice;
no one is going to do it for you.
Creativity creates the evil as well.
Lizzie Short ’12
In My Mothers House
Little light bottles
For medicine once, now for sun
A sh-shaped bottle, a turquoise one, bright blue
A light-refracting disk, so that our kitchen can be painted
In all the moving colors in the morning.
It is night now.
My mother and I in my parents’ big bed
Watching a PBS programme
Of Peter, Paul, and Mary
By lamplight.
My mother, so thin and small, in her classic post-9pm repose;
Hair: slightly damp. A glass of white wine
And her nightly dose of PBS.
My mother, with her pert chin jutting against her navy pajama shirt
Sings along
With Peter, Paul, and Mary.
is song came out when I was thirteen.
My eyes burn with hot salt as I think of
My dear, skinny, little thirteen-year-old mother
Listening to Peter, Paul and Mary on the radio
In the kitchen of her Cambridge apartment
A kitchen without light bottles or rainbows
A kitchen two streets down
From her best friend, Janie Quinn.
36
37
Jacob Kupferman ’14
Sunset Over the Connecticut River
38
39
Renée Gauthier ‘12
Spitting Image
e rst thing most people noticed about Amy Healeys four-year-old daughter
Kelsey was that she was a miniature version of her mother. She had Amy’s brown eyes, her
dishwater-blonde hair, and just the right amount of age-appropriate chubbiness. She was,
by all accounts, an adorable little girl, except for when she was in the throes of an occasional
temper tantrum. Unfortunately for all involved, now was one of those times.
“I dont like that dress!” she screamed, wiggling and waving her arms as her mother
tried to grab one of the dangerously ailing limbs and stu it into the sleeve of the oending
garment. “I dont like it!!!”
“You liked it just ne when we picked it out,” Amy said impatiently. “Stop moving,
Kelsey!”
Kelsey redoubled her eorts to wriggle free and began wailing, “No-no-no-no-
no- nooooo!” Amy ignored her and yanked the sleeve further up her daughters arm before
turning her attention to the other side of the outt. She glared at a few nearby mothers who
were casting critical looks in her direction and caught Kelseys other hand, guiding it with
some diculty into the other sleeve. Her movements thus restricted, Kelsey let out a long,
wordless wail and dissolved into tears, standing stock-still as her mother zippered her up the
back.
“Youd think I was torturing you,” Amy said in what she hoped was a lighthearted
voice, mostly for the benet of the holier-than-thou mothers still watching. “Dont you like
this dress? Isnt it pretty?” She glanced over at the mothers and gave them an apologetic smile.
“Shes always like this before a big one. Its the nerves.” A couple of the mothers nodded
in understanding and turned away, but one or two let their gazes linger on disapprovingly.
Amy tried to ignore them. It was always like this on the pageant circuit. Some mothers just
couldnt stand the fact that other womens daughters were cuter or more talented or more
poised. Amy prided herself on her own attitude. She never resorted to the nasty looks or the
passive-aggressive comments that came so naturally to some of the other moms. Pageants
were her own thing, hers and Kelseys, and all that mattered was Kelsey’s own performance.
And Kelseys performances were always winners.
At home, Kelseys bedroom was lled with trophies that proclaimed her Little Miss
is or at. Her walls were hung with sashes and medals, and she had so many tiaras that
almost all of her dolls and stued animals wore at least one. Sometimes when Amy was
returning some misplaced toys to Kelseys room or putting some clean laundry in the dresser,
she would just stop and stare at the titles—Grand Supreme, Ultimate Grand Supreme, Junior
Miss Elite, Queen of Queens—and marvel at what she and Kelsey had been able to achieve
together. It was unfortunate that pageants got such a bad rap, she would muse as she blew
some dust o a trophy and straightened a teddy bears lopsided crown. Kelsey was learning
poise. She was developing a skill. Not many kids got those kinds of opportunities so early
on—Amy certainly hadnt.
She found herself thinking along the same lines as she managed to get a subdued
but still sulking Kelsey into a chair to have her hair done and her make-up touched up.
Kelsey would have the world at her feet. She could be a model, an actress, maybe even Miss
America. She could win a scholarship to college, a good college, not a two-year commuter
school like the one Amy had attended, the one that lost its accreditation the same year that
Kelsey was born. She would have dozens—no, hundreds—of options.
It was hard to explain all of this to a six-year-old, so Amy didnt try. Instead, she
teased Kelseys hair and some lighter blonde extensions into a glamorous-looking pouf, curled
the ends, and hairsprayed the hell out of it while Kelsey shielded her face with her hands.
She reapplied the makeup where the tear tracks from Kelseys tantrum had messed it up and
brushed some bronzer on top. She successfully inserted the ipper teeth to hide the gaps
where Kelseys baby teeth had fallen out. And nally, she managed to get colored contacts
into Kelseys eyes. is of course resulted in another tantrum and more makeup-retouching,
but by the end of the entire ordeal Kelsey looked picture perfect. e deep turquoise dress
made the blue contact lenses pop, and Amy couldnt help but feel satised that theyd decided
to try the contacts—they really completed the look. She applied a dusting of glitter to
Kelseys face, gave her two air kisses so as not to ruin the work of the last hour, and sent her
o—tanned, blonde, and sparkly—to wait her turn in the wings.
When Amy took a seat in the audience a few minutes later, the woman next to her
smiled at her. “Which ones yours?” she asked, jerking her head toward the stage, where all
the contestants were parading out in a wobbly line. Amy told her.
“I’d never’ve guessed,” the woman remarked politely. “She doesnt look a bit like
you.
And under the stage lights, with makeup and blonde hair and blue eyes and perfect
teeth and a pretty dress, she didnt.
40
41
Annie Gardner ’15
Storm for Breakfast
When we woke up the clouds had spread
across the sky like grape jam.
Big dark purple clumps
making the air heavy and sticky.
Waking up next to you I expected
the clouds to crack like an egg,
exposing a round yellow yolk
sliding across a blue pan.
But you burnt the toast
And covered it up with grape jam.
Genevieve Miin ’14
Transitions
42
43
Billy Zou ’12
excerpt from e Undead
ough I know that evenins empire has returned into sand
Vanished from my hand
Left me blindly here to stand but still not sleeping
My weariness amazes me, I’m branded on my feet
I have no one to meet
And the ancient empty streets too dead for dreaming
Bob Dylan
Claire wades through the room with a half-empty wineglass and nds Emma by the bar with
Will. —Hey Em, you should probably see this.
—What’s up? She asks, but Claires expression is serious. e three of them make their way
back through the crowd toward the French windows leading to the balcony.
ey step out onto the balcony with its white balusters, and look out across the street.
—Can you see who it is? asks Will.
Emma can see, and she feels the panic well up inside of her. Her senses sharpen and the
alcohol drains from her head. She feels her heart race, the air press up against her lungs.
—You guys should go back inside.
Claire nods. —Should I call S&S?
Emma thinks. —No, dont. Her eyes trace out the scene. She can hear the two boys shouting
from the street and Robert’s roaring voice from the open second-story window.
—Dude you cant get on the roof and then not jump. What kind of shit is that.
—You need to fuck o right now.
Claire puts her hand on Will’s shoulder. —Come on.
—I’ll wait for Emma. Shouldnt we call S&S?
—She’ll be right in. Claire brings him inside and whispers something but they stand and
watch by the window.
Emma inhales sharply. —Hey. But her voice dissolves thinly into the commotion. —Hey!
Now they turn their heads to see.
—What’s your name? She calls to them on the street. ey turn away to ignore her, but this
incenses her more. —Hey! I asked you a question. Whats your name? I’m talking to you. My
names Emma, whats yours?
Jeremy sees her now. Shes wearing a yellow dress like the one she wore with him to Lake
Champlain. ere had been a formal on a boat out on the lake and music and dancing and
thered been a girl who had drank too much and fallen overboard, and hed jumped in and
pulled her out of the water while her date stood there and watched. It makes him dizzy to
think about it now. His knees felt weak and he imagines momentarily the sensation of falling,
the soft loamy impact of earth against his skull.
e boy in the sweatshirt whispers something to his friend. He pulls the hood over his head,
his voice lackluster now and humorless. —Were not leaving until you jump, so you might as
well get it over with.
Emma knew she had them. —Hey I know who you are! She’s talking to their backs. —You
work in the Presidents oce. Your names Colin and his is Parker. You, youre one of the
Tucker chairs, arent you? I think we took a skiing class together one time.
—What the fuck? ey try to laugh it o. —Who is this girl? Do you know her?
—Let’s go, I dont want anything to do with this.
—Hes not going to do it, let’s go.
One of them shouts back to her. —Hey, I dont who youre talking about. ey walk o
slowly toward the library, their forms folding into the shadows, join once more the lurching,
faceless gures of night.
Emma exhales. —Jeremy you idiot, get o the roof. Go inside, youre drunk.
—We were playing zombies. He smiles.
ey stand there for a minute, her on the balcony and him on the roof. Emma with her
hands curled up against the railing, Jeremy with his hands in his pockets, shoulders leaned
back like hes out observing the stars, their breath fogging up the air between their faces,
and it’s not very far across from one side of Webster to the other or it’s true that the houses
change their places because on some nights it seems that it’s an eternity escaping from the
stale, musty underground to the comfort of the Choates and other nights it’s hardly a walk
and yet others they all melt together indistinguishably...
—Rob help get him back inside, cant you see he cant stand straight. Hes going to slip and
fall, hes going to get arrested.
Robert steps through the window and grabs hold of Jeremy’s shoulder. —Hey, come on. Hey
Jerm. Let’s nd some people with brains.
Jeremy pauses, his back turned to the people watching from the house, then smiling he
reaches out toward her into the night with his limp, undead arms, and Emma looks at him,
and she holds up her hands locked into the shape of a gun, and res a single shot through the
dark, impalpable stillness of Webster Avenue.
44
45
Rebecca Rothfeld ’14
Capgras Syndrome
One day you were
no longer you. Youd
swallowed yourself in the deep
of your sleep and escaped
through the door in the side of
your gut. By the time I awoke,
already too late, I noticed
the violate window agape,
long curtains contorted with
unbidden breeze, the covers
drawn back on the bed’s naked
thigh. ere hadnt been time
for notes or goodbyes, just
enough to collect what you thought
you might need, your books and
your socks, a couple of shirts, old letters
addressed to a self days away.
Strangers in the kitchen are
scrambling eggs. Interred in
the tub I am turning taps cold,
my ngers all wrinkling like rot-ripened
fruit. I plead with your captors
for your safe return. What have they done
with your voice, with your hands? And where
is there room for the greens of your eyes?
No prison could house all these
transient selves, no ransom recover
the bulk of your being, the someone
who shuddered in my sleepy holding
and howled at my partings, demanding
I stay. On the day of
betrayal I’ll unbuild my bearings,
nd my clothing too big and mirrors all
distortive, the shelves lined with books that
I’ve never purchased, and myself
coyly kidnapped: weve all been replaced.
Daegwon Chae ’15
Watershed
e night before the weather cleared
it rained for just a minute. And through
the paint-chipped ceiling dropped
a single bead of blue upon
my bedside table. I like to think
the water came from many places:
mist from Japan, fog from the Tropics,
and steam from boiling tea above
a paltry ame that seems like dancing
wisps of golden leaves to lonely
campers in Antarctica.
46
47
Henry Russell ’15
e Call
I found my father’s hunting dog nose deep
in a nest of mice behind Sullivans lot.
e pink underbelly of the mother
broke in his jaw, spurted blood-arc.
e red, clouding in the snow,
trolled his jawline like wine
down my fathers blushed cheek
in a picture from his wedding night.
I kicked him in the gut with my boot—
the young burrowing out of reach—
and he let her drop. Grey-red esh
and pus smacked snow, heartbeat
under skin, quick as dog years— there,
but hardly ever, like snowakes in streetlamps,
Lindsay sitting on my lap at Verrocis gate,
my hand, for once, in her silver-red hair.
And now, I see it all:
the tremor on her stomach,
body warmth melting the snow beneath her,
the dog’s back-look, (Is it guilt?)
edging into tree cover.
e only time I snuck back late,
my father caught me, showed for the rst time,
his top front teeth are fake,
the real ones bludgeoned down his throat
by a hulking back, called from the bench
to start at Memorial. at night,
Lindsay left me at drives end.
Her dress, dogwood-printed pink,
ushed bare shoulder,
and my gut’s desire to turn back,
deep, and rising. e door cracked
orange glow, and I nd my father,
still up with Kess, hunched
at the desk lamp, teaching himself to read.
Months later, running for distance
in the dusk along her lot, I hear
the call to heart, the turnover of legs
that rip the deer path around her sycamore,
back and back, into the Indian graveyard
like Londons wolf-dog
who never forgot his mother.
As a kid, I put Fang
under my pillow, to pack in dreams
through timber woods, and now,
on the night before we graduate,
I hear it louder than ever—
coyote chatter, play-call for rabbit hunt,
moon-salute against cicada drone.
Her bed lamp, across the hayeld, kindles
natures drive for her within me and suddenly,
I’m taken back to a white hall,
the choke in my father’s throat
I barely caught. is woman,
thumbing syringe, signals for me to go,
and, turning,
I catch the back-look of the black mutt,
tired, maybe, of instinct.
at night, I found a manila letterhead
my father, the dyslexic, tucked under my pillow.
How long did it sit there?
A day. Maybe seven.
It said: We feel what we must.